Reacción en cadena de la polimerasa (PCR)

15 02 2016

Esta película necesita Flash Player 7



La regulación de la expresión génica. El operón lac

22 01 2016

 Las células no sintetizan de forma continua todos los tipos de proteínas sobra las que tienen información, sino que existe un sistema de regulación.

Como la cantidad de proteínas que se sintetiza depende de la cantidad de ARNm presente en el citoplasma, y su estabilidad es muy corta (minutos), la cantidad de ARNm sintetizado regula los niveles enzimáticos del medio. Por tanto, la regulación de la síntesis de ARNm regula el metabolismo celular.

La síntesis de ARNm depende, en procariotas, del sustrato disponible, y en eucariotas, de las concentraciones hormonales del medio interno

Esta película necesita Flash Player 7

Leer más »



La expresión génica. La transcripción y la traducción, biosíntesis de proteínas

21 01 2016

La expresión del mensaje genético

Esta película necesita Flash Player 7

 

Hacer click en este enlace para ver el mecanismo en animación flash

Leer más »



El mecanismo de la duplicación del ADN

16 01 2016

Duplicación del ADN en células procariotas

La duplicación en las bacterias se desarrolla, básicamente, en dos fases:

- Fase de iniciación

- Fase de elongación

Esta película necesita Flash Player 7

Hacer click en este enlace para ver el mecanismo en animación flash

Leer más »



Diagnóstico genético

1 03 2015

Imaginar que formáis parte de un equipo de diagnóstico de enfermedades mediante la investigación de secuencias de ADN.

Os llega el caso de un paciente  con los siguientes síntomas

  • Fatiga
  • Palidez
  • Frecuencia cardíaca rápida
  • Dificultad respiratoria
  • Color amarillento de los ojos y la piel (ictericia)

En el análisis de sangre habéis obtenido la siguiente imagen de sus eritrocitos:

sicklecells.jpg

 

En los que se puede observar como algunos adquieren una forma atípica de bastón  o de hoz

Ante la sospecha de un defecto en la hemoglobina, extraéis una muestra de ADN para obtener un fragmento de la secuencia que codifica la información de la hemoglobina.

También tenéis un fragmento de la secuencia de aminoácidos de una molécula normal de hemoglobina.

Datos:

1. El fragmento de la secuencia de aminoácidos de la hemoglobina de una persona sana es el siguiente:

valina histidina leucina treonina prolina a.glutámico a.glutámico lisina

2. La secuencia de la muestra del ADN del paciente es la siguiente:

  5´GTACATCTCACTCCAGTGGAGAAA3´

  3´CATGTAGAGTGAGGTCACCTCTTT5´

Tarea:

A partir de la secuencia de bases de la cadena 3´→5´ transcribe el ARNm correspondiente y elabora con la ayuda del código genético la secuencia de aminoácidos y compáralo con la de la hemoglobina normal.

codigo-genetico.png

Código genético

Resultado y diagnóstico:

¿Qué es lo que has encontrado? ¿Existe alguna diferencia entre las dos secuencias de proteínas? Con los resultados elabora tu diagnóstico en el que describas la enfermedad,  su origen genético y los defectos que causa.

Puedes encontra información en: http://www.nlm.nih.gov/medlineplus/spanish/ency/article/000527.htm

 



La expresión de la información genética. La síntesis de proteínas

28 02 2015

 

Después de ver el vídeo, responde a las siguientes cuestiones sobre la expresión de la información genética:

1.      ¿Qué es un gen?

2.      ¿En qué consiste la transcripción del mensaje genético?

3.      ¿Qué es un triplete? ¿Cómo se denominan los tripletes en el ARNm?

4.      ¿Qué se entiende por código genético?

5.      ¿Por qué se dice que el código genético es universal?

6.      ¿Cuál es la función del ARN de transferencia (ARNt)

7.      ¿Qué es la traducción del mensaje genético?

8.      ¿Cómo se inicia el proceso de traducción celular?

9.      ¿Cómo sigue el proceso de traducción?, y ¿cuándo finaliza?

10.  ¿En qué momento de la vida de la célula tiene lugar el proceso de la expresión de la información genética?